Project 3 > Mutation Database > MYBPC3 mutations > IVS8+1G>A

The IVS8+1G>A mutation of human cardiac Myosin-Binding Protein C

(other names:  Int8DSG+1A)

SEQUENCE
intron 8
nucleotide change G>A
nucleotide pos. in gene 5824
UCSC Golden Path position 47325983
charge change  
codon change  
transcript change splice donor site
translation change  


mutated amplimer sequence:
gcttctcaaacggccccctctgaagccccttcccccatctctccaccctt
tgaacccagaggccatgggcaccggagacctggacctcctatcagccttc
cgccgcacAtgagtggccatcctcagggcctgggggaggccagtgctgga
gtctgaggcccttcagggtctcgactgggggtcagggctggggatgattt
gcggggcggagct


RESTRICTION ENZYME
no information

 
disease HCM

 
    References and comments
  1. Niimura H, Bachinski LL, Sangwatanaroj S, Watkins H, Chudley AE, McKenna W, Kristinsson A, Roberts R, Sole M, Maron BJ, Seidman JG, Seidman CE.
    Mutations in the gene for cardiac myosin-binding protein C and late-onset familial hypertrophic cardiomyopathy.
    N Engl J Med 1998 Apr 30;338(18):1248-57. (PubMed:9562578)
  2. Maron BJ, Niimura H, Casey SA, Soper MK, Wright GB, Seidman JG, Seidman CE.
    Development of left ventricular hypertrophy in adults in hypertrophic cardiomyopathy caused by cardiac myosin-binding protein C gene mutations.
    J Am Coll Cardiol 2001 Aug;38(2):315-21. (PubMed:11499718)
  3. Merk, Seidman et al., 2004. (this study)
  4. Van Driest SL, Vasile VC, Ommen SR, Will ML, Tajik AJ, Gersh BJ, Ackerman MJ.
    Myosin binding protein C mutations and compound heterozygosity in hypertrophic cardiomyopathy.
    J Am Coll Cardiol 2004 Nov 2;44(9):1903-10. (PubMed:15519027)
 

citations & disclaimer | contact us

Last modified: April 24, 2006