Project 3 > Mutation Database > MYBPC3 mutations > Gly263Arg

The Gly263Arg mutation of human cardiac Myosin-Binding Protein C

(other names:  G263R)

SEQUENCE
exon 8
nucleotide change G>A
nucleotide pos. in gene 5789
UCSC Golden Path position 47326018
amino acid changeGly>Arg
charge change +1
codon change  
transcript change missense
translation change substitution


mutated amplimer sequence:
gcttctcaaacggccccctctgaagccccttcccccatctctccaccctt
tgaacccagaggccatgggcaccAgagacctggacctcctatcagccttc
cgccgcacgtgagtggccatcctcagggcctgggggaggccagtgctgga
gtctgaggcccttcagggtctcgactgggggtcagggctggggatgattt
gcggggcggagct


RESTRICTION ENZYME
no information

 
disease HCM

 

Date this novel mutation was originally posted on this website:   9/28/2001

    References and comments
  1. Barr, Seidman et al., 2001. (this study)
  2. Song L, Zou Y, Wang J, Wang Z, Zhen Y, Lou K, Zhang Q, Wang X, Wang H, Li J, Hui R.
    Mutations profile in Chinese patients with hypertrophic cardiomyopathy.
    Clin Chim Acta 2005 Jan;351(1-2):209-16. (PubMed:15563892)


Clinical features of individuals in this study having the MYBPC3:Gly263Arg mutation.
pedigree sex height (in.) weight (lb.) age of onset age at exam NYHA Class LVWT, mm. LVED LVES LA EF, % diagnosis
HO M   223   75 II 17 53 38 45 75 HCM

citations & disclaimer | contact us

Last modified: April 24, 2006