Project 3 > Mutation Database > MYBPC3 mutations > Glu451Gln

The Glu451Gln mutation of human cardiac Myosin-Binding Protein C

(other names:  E451Q)

SEQUENCE
exon 16
nucleotide change G>C
nucleotide pos. in gene 10628
UCSC Golden Path position 47321148
amino acid changeGlu ĘGln
charge change  
codon change GAG>CAG
transcript change complex
translation change  
commentSpans a splice site, G|AG>C|AG


mutated amplimer sequence:
aacacttcaacggccccttctgttctacagcaagtaagttcccctctgga
tggcttggggtggggggcacagggattatcacggggcgcactgggcccgg
aggggtgtccgcagctttcctgccacttccctgcggcccccacccaggta
catctttgagtccatcggtgccaagcgtaccctgaccatcagccagtgct
cattggcggacgacgcagcctaccagtgcgtggtgggtggcgagaagtgt
agcacggagctctttgtgaaaCgtgggcctgggacctgaggatgtgggaa
cctggggaggagatggcctcaggggagccaaccctcatgctcaccctgcc
tggacagagccccctgtgctcatcacgcgccccttggaggaccagctggt
gatggtggggcagcgggtggagtttgagtgtgaagtatcggaggaggggg
c


RESTRICTION ENZYME
no information

 
disease HCM

 
    References and comments
  1. Solomon SD, Jarcho JA, McKenna W, Geisterfer-Lowrance A, Germain R, Salerni R, Seidman JG, Seidman CE.
    Familial hypertrophic cardiomyopathy is a genetically heterogeneous disease.
    J Clin Invest 1990 Sep;86(3):993-9. (PubMed:1975599)
  2. Niimura H, Bachinski LL, Sangwatanaroj S, Watkins H, Chudley AE, McKenna W, Kristinsson A, Roberts R, Sole M, Maron BJ, Seidman JG, Seidman CE.
    Mutations in the gene for cardiac myosin-binding protein C and late-onset familial hypertrophic cardiomyopathy.
    N Engl J Med 1998 Apr 30;338(18):1248-57. (PubMed:9562578)


Clinical features of individuals in this study having the MYBPC3:Glu451Gln mutation.
pedigree sex height (in.) weight (lb.) age of onset age at exam NYHA Class LVWT, mm. LVED LVES LA EF, % diagnosis
DI M     69   II 26     46    
DI F     56   IV 15     52    
DI M     35   I 17     29    
DI F     25   II 27     37    
DI M     47   I 25     49    
DI M     41   IV 17     49    
DI M     35   I 25     39    
DI F     52   I 35     35    
DI M     34   I 13     38    
P F           31     41   HCM
P M           23     39   HCM
P M           16 39 24 38 77 HCM
P M                 38   HCM
P M           21     46   HCM
P F             44 27 32   HCM
P M           26     46   HCM
P F           14     35   HCM

citations & disclaimer | contact us

Last modified: April 24, 2006