Project 3 > Mutation Database > MYBPC3 mutations > Glu258Lys

The Glu258Lys mutation of human cardiac Myosin-Binding Protein C

(other names:  E258K, , )

mutated amplimer sequence:
ctggagctcctggtcttatgtgatccgcccgcctcagcctcccaaagtgg
ggattacaggcctgagccaccgcgcccggccactcccagtctcctttaag
ggtgcggagccttgtctcccggcccctggtgtcccctgacgccccgtccc
tccatgcacacaggtctatctgttcgagctgcacatcaccgatgcccagc
ctgccttcactggcagctaccgctgtgaggtgtccaccaaggacaaattt
gactgctccaacttcaatctcactgtccacAgtgagggggccctggtgtc
tgtcctgggctcgggctccccatgggtcctggtctcctacctccttttcc
caacactaaggaggatgcctcgtcccatccagacatgagtgctggccacg
tgcccagtgctgcacacacagggtgtgagagaaaccccaaggcttgcagg
gtaggcgtgggggcttagggctgagtccgggtctcatctgggtgggactc
tgttttatcatcttggtgtcacggctcc

References and comments
1. Niimura H, Bachinski LL, Sangwatanaroj S, Watkins H, Chudley AE, McKenna W, Kristinsson A, Roberts R, Sole M, Maron BJ, Seidman JG, Seidman CE.
   Mutations in the gene for cardiac myosin-binding protein C and late-onset familial hypertrophic cardiomyopathy.
   N Engl J Med 1998 Apr 30;338(18):1248-57. (PubMed:9562578)
2. Richard P, Charron P, Carrier L, Ledeuil C, Cheav T, Pichereau C, Benaiche A, Isnard R, Dubourg O, Burban M, Gueffet JP, Millaire A, Desnos M, Schwartz K, Hainque B, Komajda M.
   Hypertrophic cardiomyopathy: distribution of disease genes, spectrum of mutations, and implications for a molecular diagnosis strategy.
   Circulation 2003 May 6;107(17):2227-32. Epub 2003 Apr 21. (PubMed:12707239)
3. Nanni L, Pieroni M, Chimenti C, Simionati B, Zimbello R, Maseri A, Frustaci A, Lanfranchi G.
   Hypertrophic cardiomyopathy: two homozygous cases with 'typical' hypertrophic cardiomyopathy and three new mutations in cases with progression to dilated cardiomyopathy.
   Biochem Biophys Res Commun 2003 Sep 19;309(2):391-8. (PubMed:12951062)
4. Alders M, Jongbloed R, Deelen W, van den Wijngaard A, Doevendans P, Ten Cate F, Regitz-Zagrosek V, Vosberg HP, van Langen I, Wilde A, Dooijes D, Mannens M.
   The 2373insG mutation in the MYBPC3 gene is a founder mutation, which accounts for nearly one-fourth of the HCM cases in the Netherlands.
   Eur Heart J 2003 Oct;24(20):1848-53. (PubMed:14563344)
   • compound heterozygote, with MYBPC3:Arg834Trp
5. Van Driest SL, Vasile VC, Ommen SR, Will ML, Tajik AJ, Gersh BJ, Ackerman MJ.
   Myosin binding protein C mutations and compound heterozygosity in hypertrophic cardiomyopathy.
   J Am Coll Cardiol 2004 Nov 2;44(9):1903-10. (PubMed:15519027)
   • compound heterozygote, with MYBPC3:Pro955fs
   • Not present in 400 reference alleles.
6. Song L, Zou Y, Wang J, Wang Z, Zhen Y, Lou K, Zhang Q, Wang X, Wang H, Li J, Hui R.
   Mutations profile in Chinese patients with hypertrophic cardiomyopathy.
   Clin Chim Acta 2005 Jan;351(1-2):209-16. (PubMed:15563892)
7. Sarikas A, Carrier L, Schenke C, Doll D, Flavigny J, Lindenberg KS, Eschenhagen T, Zolk O.
   Impairment of the ubiquitin-proteasome system by truncated cardiac myosin binding protein C mutants.
   Cardiovasc Res. 2005 Apr 1;66(1):33-44. (PubMed:15769446)
   • This mutation alters splicing so that exon 6 is skipped and a truncated polypeptide is produced.

citations & disclaimer | contact us

Last modified: April 24, 2006